github.com/razvanm/vanadium-go-1.3@v0.0.0-20160721203343-4a65068e5915/test/bench/shootout/fasta.go (about) 1 /* 2 Redistribution and use in source and binary forms, with or without 3 modification, are permitted provided that the following conditions are met: 4 5 * Redistributions of source code must retain the above copyright 6 notice, this list of conditions and the following disclaimer. 7 8 * Redistributions in binary form must reproduce the above copyright 9 notice, this list of conditions and the following disclaimer in the 10 documentation and/or other materials provided with the distribution. 11 12 * Neither the name of "The Computer Language Benchmarks Game" nor the 13 name of "The Computer Language Shootout Benchmarks" nor the names of 14 its contributors may be used to endorse or promote products derived 15 from this software without specific prior written permission. 16 17 THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" 18 AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE 19 IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE 20 ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE 21 LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR 22 CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF 23 SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS 24 INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN 25 CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) 26 ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE 27 POSSIBILITY OF SUCH DAMAGE. 28 */ 29 30 /* The Computer Language Benchmarks Game 31 * http://shootout.alioth.debian.org/ 32 * 33 * contributed by The Go Authors. 34 * Based on C program by by Petr Prokhorenkov. 35 */ 36 37 package main 38 39 import ( 40 "flag" 41 "os" 42 ) 43 44 var out = make(buffer, 0, 32768) 45 46 var n = flag.Int("n", 1000, "length of result") 47 48 const Line = 60 49 50 func Repeat(alu []byte, n int) { 51 buf := append(alu, alu...) 52 off := 0 53 for n > 0 { 54 m := n 55 if m > Line { 56 m = Line 57 } 58 buf1 := out.NextWrite(m + 1) 59 copy(buf1, buf[off:]) 60 buf1[m] = '\n' 61 if off += m; off >= len(alu) { 62 off -= len(alu) 63 } 64 n -= m 65 } 66 } 67 68 const ( 69 IM = 139968 70 IA = 3877 71 IC = 29573 72 73 LookupSize = 4096 74 LookupScale float64 = LookupSize - 1 75 ) 76 77 var rand uint32 = 42 78 79 type Acid struct { 80 sym byte 81 prob float64 82 cprob float64 83 next *Acid 84 } 85 86 func computeLookup(acid []Acid) *[LookupSize]*Acid { 87 var lookup [LookupSize]*Acid 88 var p float64 89 for i := range acid { 90 p += acid[i].prob 91 acid[i].cprob = p * LookupScale 92 if i > 0 { 93 acid[i-1].next = &acid[i] 94 } 95 } 96 acid[len(acid)-1].cprob = 1.0 * LookupScale 97 98 j := 0 99 for i := range lookup { 100 for acid[j].cprob < float64(i) { 101 j++ 102 } 103 lookup[i] = &acid[j] 104 } 105 106 return &lookup 107 } 108 109 func Random(acid []Acid, n int) { 110 lookup := computeLookup(acid) 111 for n > 0 { 112 m := n 113 if m > Line { 114 m = Line 115 } 116 buf := out.NextWrite(m + 1) 117 f := LookupScale / IM 118 myrand := rand 119 for i := 0; i < m; i++ { 120 myrand = (myrand*IA + IC) % IM 121 r := float64(int(myrand)) * f 122 a := lookup[int(r)] 123 for a.cprob < r { 124 a = a.next 125 } 126 buf[i] = a.sym 127 } 128 rand = myrand 129 buf[m] = '\n' 130 n -= m 131 } 132 } 133 134 func main() { 135 defer out.Flush() 136 137 flag.Parse() 138 139 iub := []Acid{ 140 {prob: 0.27, sym: 'a'}, 141 {prob: 0.12, sym: 'c'}, 142 {prob: 0.12, sym: 'g'}, 143 {prob: 0.27, sym: 't'}, 144 {prob: 0.02, sym: 'B'}, 145 {prob: 0.02, sym: 'D'}, 146 {prob: 0.02, sym: 'H'}, 147 {prob: 0.02, sym: 'K'}, 148 {prob: 0.02, sym: 'M'}, 149 {prob: 0.02, sym: 'N'}, 150 {prob: 0.02, sym: 'R'}, 151 {prob: 0.02, sym: 'S'}, 152 {prob: 0.02, sym: 'V'}, 153 {prob: 0.02, sym: 'W'}, 154 {prob: 0.02, sym: 'Y'}, 155 } 156 157 homosapiens := []Acid{ 158 {prob: 0.3029549426680, sym: 'a'}, 159 {prob: 0.1979883004921, sym: 'c'}, 160 {prob: 0.1975473066391, sym: 'g'}, 161 {prob: 0.3015094502008, sym: 't'}, 162 } 163 164 alu := []byte( 165 "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + 166 "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + 167 "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + 168 "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + 169 "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + 170 "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + 171 "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA") 172 173 out.WriteString(">ONE Homo sapiens alu\n") 174 Repeat(alu, 2**n) 175 out.WriteString(">TWO IUB ambiguity codes\n") 176 Random(iub, 3**n) 177 out.WriteString(">THREE Homo sapiens frequency\n") 178 Random(homosapiens, 5**n) 179 } 180 181 type buffer []byte 182 183 func (b *buffer) Flush() { 184 p := *b 185 if len(p) > 0 { 186 os.Stdout.Write(p) 187 } 188 *b = p[0:0] 189 } 190 191 func (b *buffer) WriteString(s string) { 192 p := b.NextWrite(len(s)) 193 copy(p, s) 194 } 195 196 func (b *buffer) NextWrite(n int) []byte { 197 p := *b 198 if len(p)+n > cap(p) { 199 b.Flush() 200 p = *b 201 } 202 out := p[len(p) : len(p)+n] 203 *b = p[:len(p)+n] 204 return out 205 }