golang.org/x/exp@v0.0.0-20240506185415-9bf2ced13842/shootout/fasta.go (about) 1 //go:build ignore 2 // +build ignore 3 4 /* 5 Redistribution and use in source and binary forms, with or without 6 modification, are permitted provided that the following conditions are met: 7 8 * Redistributions of source code must retain the above copyright 9 notice, this list of conditions and the following disclaimer. 10 11 * Redistributions in binary form must reproduce the above copyright 12 notice, this list of conditions and the following disclaimer in the 13 documentation and/or other materials provided with the distribution. 14 15 * Neither the name of "The Computer Language Benchmarks Game" nor the 16 name of "The Computer Language Shootout Benchmarks" nor the names of 17 its contributors may be used to endorse or promote products derived 18 from this software without specific prior written permission. 19 20 THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" 21 AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE 22 IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE 23 ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE 24 LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR 25 CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF 26 SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS 27 INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN 28 CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) 29 ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE 30 POSSIBILITY OF SUCH DAMAGE. 31 */ 32 33 /* The Computer Language Benchmarks Game 34 * http://shootout.alioth.debian.org/ 35 * 36 * contributed by The Go Authors. 37 * Based on C program by by Petr Prokhorenkov. 38 */ 39 40 package main 41 42 import ( 43 "flag" 44 "os" 45 ) 46 47 var out = make(buffer, 0, 32768) 48 49 var n = flag.Int("n", 1000, "length of result") 50 51 const Line = 60 52 53 func Repeat(alu []byte, n int) { 54 buf := append(alu, alu...) 55 off := 0 56 for n > 0 { 57 m := n 58 if m > Line { 59 m = Line 60 } 61 buf1 := out.NextWrite(m + 1) 62 copy(buf1, buf[off:]) 63 buf1[m] = '\n' 64 if off += m; off >= len(alu) { 65 off -= len(alu) 66 } 67 n -= m 68 } 69 } 70 71 const ( 72 IM = 139968 73 IA = 3877 74 IC = 29573 75 76 LookupSize = 4096 77 LookupScale float64 = LookupSize - 1 78 ) 79 80 var rand uint32 = 42 81 82 type Acid struct { 83 sym byte 84 prob float64 85 cprob float64 86 next *Acid 87 } 88 89 func computeLookup(acid []Acid) *[LookupSize]*Acid { 90 var lookup [LookupSize]*Acid 91 var p float64 92 for i := range acid { 93 p += acid[i].prob 94 acid[i].cprob = p * LookupScale 95 if i > 0 { 96 acid[i-1].next = &acid[i] 97 } 98 } 99 acid[len(acid)-1].cprob = 1.0 * LookupScale 100 101 j := 0 102 for i := range lookup { 103 for acid[j].cprob < float64(i) { 104 j++ 105 } 106 lookup[i] = &acid[j] 107 } 108 109 return &lookup 110 } 111 112 func Random(acid []Acid, n int) { 113 lookup := computeLookup(acid) 114 for n > 0 { 115 m := n 116 if m > Line { 117 m = Line 118 } 119 buf := out.NextWrite(m + 1) 120 f := LookupScale / IM 121 myrand := rand 122 for i := 0; i < m; i++ { 123 myrand = (myrand*IA + IC) % IM 124 r := float64(int(myrand)) * f 125 a := lookup[int(r)] 126 for a.cprob < r { 127 a = a.next 128 } 129 buf[i] = a.sym 130 } 131 rand = myrand 132 buf[m] = '\n' 133 n -= m 134 } 135 } 136 137 func main() { 138 defer out.Flush() 139 140 flag.Parse() 141 142 iub := []Acid{ 143 {prob: 0.27, sym: 'a'}, 144 {prob: 0.12, sym: 'c'}, 145 {prob: 0.12, sym: 'g'}, 146 {prob: 0.27, sym: 't'}, 147 {prob: 0.02, sym: 'B'}, 148 {prob: 0.02, sym: 'D'}, 149 {prob: 0.02, sym: 'H'}, 150 {prob: 0.02, sym: 'K'}, 151 {prob: 0.02, sym: 'M'}, 152 {prob: 0.02, sym: 'N'}, 153 {prob: 0.02, sym: 'R'}, 154 {prob: 0.02, sym: 'S'}, 155 {prob: 0.02, sym: 'V'}, 156 {prob: 0.02, sym: 'W'}, 157 {prob: 0.02, sym: 'Y'}, 158 } 159 160 homosapiens := []Acid{ 161 {prob: 0.3029549426680, sym: 'a'}, 162 {prob: 0.1979883004921, sym: 'c'}, 163 {prob: 0.1975473066391, sym: 'g'}, 164 {prob: 0.3015094502008, sym: 't'}, 165 } 166 167 alu := []byte( 168 "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + 169 "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + 170 "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + 171 "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + 172 "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + 173 "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + 174 "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA") 175 176 out.WriteString(">ONE Homo sapiens alu\n") 177 Repeat(alu, 2**n) 178 out.WriteString(">TWO IUB ambiguity codes\n") 179 Random(iub, 3**n) 180 out.WriteString(">THREE Homo sapiens frequency\n") 181 Random(homosapiens, 5**n) 182 } 183 184 type buffer []byte 185 186 func (b *buffer) Flush() { 187 p := *b 188 if len(p) > 0 { 189 os.Stdout.Write(p) 190 } 191 *b = p[0:0] 192 } 193 194 func (b *buffer) WriteString(s string) { 195 p := b.NextWrite(len(s)) 196 copy(p, s) 197 } 198 199 func (b *buffer) NextWrite(n int) []byte { 200 p := *b 201 if len(p)+n > cap(p) { 202 b.Flush() 203 p = *b 204 } 205 out := p[len(p) : len(p)+n] 206 *b = p[:len(p)+n] 207 return out 208 }